Gene Synthesis

For standard complexity sequences and considering our error rate of 1 in 7500, selecting the recommended number of colonies, as shown in the graph, provides a 95% probability of finding a colony with the correct sequence.

Please note that this recommendation is a starting point. Various factors, such as vector type, sequence complexity, and sequence content, can affect colony growth. In some scenarios, selecting 2 to 3 times the recommended number of colonies may be necessary.

For Adapter-On Gene Fragments, universal adapters are synthesized onto the ends of each fragment. The adapters are 21-22 nucleotides in length. Fragments with these adapters are compatible with a number of assembly methods, namely Restriction Digestion/Ligation, Gateway, Golden Gate, and TOPO cloning.

The addition of restriction sites inside of the adapters can be used to remove adapters. TOPO cloning will work but will leave the adapters on. 

ADAPTER SEQUENCES

• For orders received before August 9, 2021, the adapter sequences are as follows:
  • 5' Adapter: GAAGTGCCATTCCGCCTGACCT
  • 3' Adapter: AGGCTAGGTGGAGGCTCAGTG
  • 5’ – GAAGTGCCATTCCGCCTGACCT – insert – AGGCTAGGTGGAGGCTCAGTG – 3'

• For orders received after August 9, 2021 to November 1, 2021, the adapter sequences are as follows:
  • 5' Adapter: CCCCGTCACCTTTGGCTTATCAGT
  • 3' Adapter: AGTGACATCTGGACGCTAAGACCG
  • 5’ - CCCCGTCACCTTTGGCTTATCAGT – insert – AGTGACATCTGGACGCTAAGACCG - 3'

• For orders received after November 2, 2021, the adapter sequences are as follows:
  • 5' Adapter: CAATCCGCCCTCACTACAACCG
  • 3' Adapter: CTACTCTGGCGTCGATGAGGGA
  • 5’ - CAATCCGCCCTCACTACAACCG – insert – CTACTCTGGCGTCGATGAGGGA - 3'

*Adapters are short sequences added to each end of the insert as part of our synthesis process. Gene fragments without these adapters are also available during the checkout process. 

If you have any questions about your order, please contact us at customersupport@twistbioscience.com  

Yes, gene fragments go through a bead-based clean up; however, short fragments can carry over in small quantities.

• For orders received before August 9, 2021, the adapter sequences are as follows:
  • 5' Adapter: GAAGTGCCATTCCGCCTGACCT
  • 3' Adapter: AGGCTAGGTGGAGGCTCAGTG
  • 5’ – GAAGTGCCATTCCGCCTGACCT – insert – AGGCTAGGTGGAGGCTCAGTG – 3'

• For orders received after August 9, 2021 to November 1, 2021, the adapter sequences are as follows:
  • 5' Adapter: CCCCGTCACCTTTGGCTTATCAGT
  • 3' Adapter: AGTGACATCTGGACGCTAAGACCG
  • 5’ - CCCCGTCACCTTTGGCTTATCAGT – insert – AGTGACATCTGGACGCTAAGACCG - 3'

• For orders received after November 2, 2021, the adapter sequences are as follows:
  • 5' Adapter: CAATCCGCCCTCACTACAACCG
  • 3' Adapter: CTACTCTGGCGTCGATGAGGGA
  • 5’ - CAATCCGCCCTCACTACAACCG – insert – CTACTCTGGCGTCGATGAGGGA - 3'

*Adapters are short sequences added to each end of the insert as part of our synthesis process. Gene fragments without these adapters are also available during the checkout process.

If you have any questions about your order, please contact us at customersupport@twistbioscience.com

You can use the following methods to clone gene fragments with adapters:

Restriction digestion/Ligation - place restriction sites inside of the Twist adapters for easy cloning

Type IIS or Golden Gate - place restriction sites inside of the Twist adapters for easy cloning TOPO cloning (blunt-end) - the adapter sequences will be cloned in as well

Gateway cloning - add attB sites to the ends of your sequence

For more information, click here.  

You can find the pricing table for Gene Fragment products in your account by clicking here.

If you need to contact your Account Manager regarding pricing, their contact information is available in eCommerce under Account.

Certificates of Analysis (COA) are available for completed orders. You can find the COA for Gene Fragment products in your account by clicking here.

Synthesis issues are driven mainly by repetitive structures, extreme GC content, and homopolymers. We use a machine learning method to determine the chance of success. Therefore, most of the time, there is no single reason for the rejection of a sequence. Rather, complexity or rejection stem from a combination of features that push a sequence into a given bucket of complexity. The only hard rules are the following:

• Avoid homopolymers >= 14bp

• Do not include CcdB (Type II Toxin-antitoxin system)

Should you encounter an issue, we recommend removing or minimizing repeats, regions of extreme GC content, and homopolymers. We will highlight regions of concern if your sequence is complex, unbuildable, or contains sequences which conflict with our internal processes.

Our website will accept amino acid sequences and convert them to a DNA sequence for synthesis.  At the upload sequences page, select the Amino Acid Sequence option.

Make sure your input only contains Amino Acid one-letter characters.  We support only the standard 20 one-letter code characters.

A "*" at the end of your amino acid sequences marks a stop codon (we do not add stop codons automatically).

Based on the Codon Usage Table you choose, the most frequently used codons will be selected.            

If you do not see your specific organism, contact customersupport@twistbioscience.com for help.

Note for Clonal Genes: Not all Twist expression vectors contain standard expression machinery upstream of the insertion point. We recommend double-checking the sequence of your final plasmid construct by clicking "Download Sequences" after selecting your desired vector.

After submitting your gene sequences on our website, they will be automatically scored for feasibility of assembly:

Standard: No errors have been found. Gene sequence found to be of "standard" overall complexity (e.g. length, GC content, homology, etc). 

Complex: No errors have been found. Some sequence complexities (e.g. length, GC content, homology, etc) exist but we do not expect any problems synthesizing your gene. Rarely, sequences may experience increased turnaround time or risk of manufacturing failure.

Error: Gene sequence contains errors. Please click on the sequence to get more details on how to resolve them.

Not Accepted: The sequence contains elements that make it impossible for us to synthesize. Please see the detailed explanations provided with the error message or refer to the “Design Guidelines”.

About Scoring System

Our scoring system adopts a machine learning model which analyzes and combines multiple sequence parameters ( i.e. overall GC percent, maximum homopolymer length, maximum repeat length, sequence length, repeat density, etc.). This model was trained using our historical manufacturing data, and it provides a more precise estimation of production success for genes and antibody products

About ISSUE messages

Warnings: Are associated with the risk of failure, predicted by the machine learning model. A higher number of warnings is more likely to result in a “Not Accepted” score.

Errors: Are not associated with gene complexity, and they can be fixed by correcting the gene design

Customers have the option of ordering oligo pools, gene fragments, and clonal genes.

Oligonucleotides (linear single-stranded DNAs) in an oligo pool can range in size from 20 bp to 300 bp.

Gene fragments are linear double-stranded DNAs that can range in size between 300 bp and 5,000 bp in length.

Clonal genes are double-stranded DNAs that have been cloned into one of Twist’s vectors or a customer-provided custom vector. Clonal genes can range in size between 300 bp and 5,000 bp in length.

Yes, there is an additional charge of $10 per gene.

Twist can clone gene synthesis products of up to 5,000 bp into any of our catalog vectors. We also offer cloning into your own custom vector.

The only Twist-provided vector that contains a Kozak sequence is pTwist ENTR Kozak. All remaining Cloning, Expression, and antibody backbone vectors offered by Twist Bioscience DO NOT contain Kozak or signal peptide (leader) sequences. Twist recommends including a Kozak (GCCGCCACC or variant) along with a signal sequence when planning to express proteins in Mammalian expression systems.

No - at this time, Twist does not have vectors for expression in plants; however, we can onboard a custom vector as long as it meets our requirements.

You can find the pricing table for Clonal Gene products in your account by clicking here.

If you need to contact your Account Manager regarding pricing, their contact information is available in eCommerce under Account.

Certificates of Analysis (COA) are available for completed orders. You can find the COA for Clonal Gene products in your account by clicking here.

Clonal Gene sequences scored as “Standard” complexity are eligible for the Express service. The Twist Bioscience eCommerce platform will score all sequences once they are uploaded and flag which ones are eligible for the Express service.

See here for additional information on sequence scoring parameters. 

No, the advertised turnaround time is the amount of time it takes to manufacture Express Genes.

All Clonal Genes (Express & Standard) are shipped using overnight or priority service.

Typical shipping times by region are as follows: 

• North America: 1-2 business days
• Europe: 2-3 business days
• Asia: 2-4 business days
• South America: 3-6 business days

Express Genes ordered with glycerol stocks and Express Genes at the 10 μg - 100 μg and 100 μg - 1 mg DNA Scales (i.e. resuspended DNA) are shipped on dry ice, which may add one business day to the overall turnaround time.

General considerations that may delay shipping and delivery include:

• Issues with payment methods
• Country-specific import requirements
• Biosafety sequence screening

No, new custom vectors will need to be onboarded prior to ordering Express Genes. New Custom Vector Onboarding will take approximately 2-3 weeks. For more information on Custom Vector Onboarding, please see the link to our FAQs for additional information.

Ordering Clonal Genes with our Express service ensures that an order receives top priority at every production stage. With additional resources dedicated to our new tier of service, this prioritized approach allows us to expedite the production of Clonal Genes without compromising quality.

Contracted pricing will be reflected in the base price of each gene, and the Express service fee is added as a separate line item relative to that contracted base price.

This indicates that we have reached maximum capacity for the current Express Genes run. Express Genes are run multiple times a day, please check back soon.

Yes, a fee is added to each gene with the Express service applied. The fee will not be invoiced for any Express Gene that does not ship within the advertised turnaround time.

Yes, the maximum limit when configuring a project on eCommerce is 1152 Express Genes. If you plan on placing an order with more than 1152 Express Genes, please contact Customer Support for help submitting your order.

The Express service is an upgraded service for Clonal Genes that provides a faster turnaround  time than our Standard service. See below for a detailed breakdown on the differences between the Standard and Express services:

Express Genes are Clonal Genes produced faster using Twist’s Express service. The Express service reduces production time as follows without compromising quality at any stage.*

1 µg - 4 µg & 4 µg - 10 µg DNA Scale:

Standard: 10 business days

Express: 4-7 business days  

10 µg - 100 µg & 100 µg - 1mg DNA Scale:

Standard: 13 business days

Express: 7-10 business days

*Terms and Conditions: Advertised turnaround time for Express Clonal Genes is 4-7 business days and is based on extensive production experience. Your production time may vary from sequence-to-sequence. International orders may require additional shipping time. Express Genes fee is based on the capacity of the chip at time of order submission and will fluctuate.

All Clonal Gene sequences between 300bp to 5000bp that are scored as “Standard” complexity by our screener are eligible for the Express service.

Our scoring system adopts a machine learning model which analyzes and combines multiple sequence parameters ( i.e. overall GC percent, maximum homopolymer length, maximum repeat length, sequence length, repeat density, etc.). This model was trained using our historical manufacturing data, and it provides a more precise estimation of production success for genes and antibody products.

Complexity issues are driven mainly by repetitive structures and extreme GC content. Guidelines for sequence design are available online and below:

• Avoid repeats of ≥ 20bp or Tm ≥ 60C 
• Global GC content must be between 25% and 65%
• Avoid extreme differences in GC content within a gene (i.e. the difference in GC content between the highest and lowest 50 bp stretch should be no greater than 52%)
• Minimize homopolymers
• Minimize the number/length of small repeats scattered throughout the sequence
• For HIS tags, use a combination of CAC and CAT codons i.e. CACCAT

The likelihood of sequence acceptance improves by limiting repeats and reducing GC content. For example: a gene may score as “Not Accepted” with 66% overall GC content, but when reduced to 65% or less, may be accepted as a “Complex” sequence. Further lowering GC content to ~60% or less may improve the complexity score to “Standard”, at which point the sequence would be eligible for the Express service. The same holds true for eliminating repeats, reducing homopolymer stretches, and evening out extreme variations in GC windows. The more such structures can be avoided or reduced in a gene, the more likely it is to qualify for the Express service.

For additional information on our scoring algorithm and sequence design, please visit our FAQs.

Express genes are available in the following DNA prep sizes: 1 μg - 4 μg, 4 μg - 10 μg, 10 μg - 100 μg and 100 μg - 1 mg. Turnaround time increases with prep size and is as follows: 4-7 business days for 1 μg - 4 μg and 4 μg - 10 μg, and 7-10 business days for 10 μg - 100 μg and 100 μg - 1 mg. The same shipment format options are available for Standard and Express genes.

Only “Standard” complexity sequences are eligible for the Express service. If a gene sequence is grayed out under the Express Genes section, that means it is a “Complex” or “Not accepted” sequence and will be marked as such in the eCommerce platform.

We continue to offer Clonal Genes produced with our Standard speed of service, which has a 10-15 business day turnaround time.

Twist is committed to providing the best experience possible. In the event Express Genes are delivered late, the Express service fee will be discounted 100% and you will be invoiced at the Standard Clonal Gene price. Terms and conditions for the policy are here.

Additionally, we stand behind Express Genes with our Twist Satisfaction Policy. In the event that you are not satisfied with your Express Genes, please notify us within thirty (30) days of order placement.

Express Genes service employs dynamic pricing to ensure availability at all times and reliable on-time delivery, especially during high-demand periods. Whenever there's a change in pricing, it will be reflected on our eCommerce platform.

Complex sequences often require more production time to synthesize and clone, and therefore, are only available at the standard production speed.

We have moved beyond simple codon frequency tables. Our new algorithm prioritizes biological expression by focusing on:

• mRNA Stability
• Secondary Structure
• Ribosome Processivity

We have decoupled manufacturability parameters from the core optimization to focus primarily on protein expression. However, if the algorithm cannot find a manufacturable solution, it will automatically attempt to fix localized regions of extreme complexity. We do this while minimizing any impact on the expression profile.

Important: While we optimize for the best possible DNA composition, please remember that protein expression is multifactorial; DNA sequence is just one of many variables influencing your final yield.

Currently, we are unable to synthesize genes that score as Impossible. There are several factors that cause our algorithm to score a gene Impossible and the specific parameters are unique to the gene sequence. Our algorithm is proprietary and was developed using machine learning. In addition to machine learning, our algorithm does take into consideration the following factors:

• %GC between 25-65%
• Max homopolymer length < 10
• Low homology

A unique combination of the above is a reflection of the specific gene sequence score of Impossible.

Twist supports over 150 organisms, including most frequently used organisms such as E. coli, human, CHO, mouse and yeast.

For Gene Fragments (either with or without adapters), you may wish to add your own restriction sites onto the ends of each fragment in order to easily clone the fragment into your vector of choice.

For Clonal Genes, simply submit the unique insert sequences that you would like us to clone into the vector backbone. We use a proprietary homology-based cloning method to assemble our clonal genes and we design and add the homologous overhang sequences for you - you do not need to consider our cloning strategy when designing your insert. 

Please note that our Cloning vectors do not have restriction sites directly flanking the insert. This allows for complete flexibility of design so that you can append the desired restriction sites onto the flanks of your insert for use in your downstream workflow.

Our Expression vector insertion points are denoted by two restriction sites - these will be fully preserved directly flanking your insert in the final construct.  We recommend that customers check the final construct sequences by clicking on the "Download sequences" button in the designer.  Once an order has been submitted for manufacturing, it cannot be altered in any way.

Twist Bioscience attests that the company adheres to all requirements in the U.S. Office of Science and Technology Policy (OSTP) Framework for Nucleic Acid Synthesis Screening. Download the attestation here.

Gene products are typically delivered as a dried-down product (unless otherwise specified).

Clonal Genes are delivered cloned into one Twist's catalog vectors or your own custom vector. Gene Fragments are delivered as linear, double stranded sequences (with or without flanking adapters).

We deliver the gene sequences in 96/384-well plates. For small orders (less than 10), the genes can be delivered in tubes at no additional cost. For orders with 10 or more genes, tube order requests are an additional $50 per order.

You can download plate map information for any order while logged in to your account. 

From the main page, click on Order & Drafts.  Then, click on Past Orders.  All of your Twist orders will appear.  Click on the order you’re interested in and on the Delivered tab, you will see a link to download your plate map.

All of our Clonal Gene synthesis products are NGS sequence verified.

Gene Fragments are not NGS verified. With a low error rate for gene synthesis, we estimate that you will need to sequence approximately 3, 4, or 6 colonies for Gene Fragments of 600, 1200, or 1800 bps respectively to obtain a sequence perfect clone with 99% confidence.

For Gene Fragments, we guarantee a yield of 100-1000 ng per fragment.

For Clonal Genes, we have a variety of yield options:

• Microprep: 1 µg - 4 µg per clone
• Miniprep: 4 µg - 10 µg per clone
• Midiprep: 10 µg - 100 µg per clone
• Maxiprep: 100 µg - 1 mg per clone

Depending on your sequence (and vector for clonal genes), the yield may be lower. If the yield is abnormally low, your gene may fail due to yield. Please note that sequences that fail for this reason will still ship, but you will not be charged. Customized target yield for miniprep scale is also available.

There are no differences in regards to the manufacturing of your gene and there are no pros or cons regarding quality - it is merely preference. Some customers prefer tubes to plates because it meets their storage needs. Other customers prefer plates because they have a high throughput workflow. Orders with 10 or more genes will be charged an additional $50 flat fee if tubes are requested.  

Twist DNA products are dried down and shipped in either 96/384-well plates or 2 ml microcentrifuge tubes. Although double-stranded DNAs are stable under most standard storage conditions, we recommend the following to maintain high quality DNA:

• Upon receipt, briefly centrifuge tube or plate and resuspend the DNA in nuclease free Tris-EDTA (TE) buffer, pH 8.0 or 10 mM Tris-HCl, pH 8.0 to the desired concentration.
• We do not recommend resuspension in water.
• A concentration of at least 10 ng/ul is recommended for a stock solution, but optimal concentration will need to be determined based on your desired application.
• Prepare aliquots of the stock and separate working aliquots to limit the chances of contamination and reduce the number of freeze/thaw cycles.
• For long term storage, freeze DNA at -20° C for up to one year, or at -80° C for even longer storage.

Resuspension guideline can be found here. 

Clonal genes have a minimum guaranteed yield of 50 ng. In a few cases, after sequence verification by NGS, we are unable to meet this minimum yield; however, we will still ship all the material we are able to recover.

For these constructs, you will see "NA" for the yield. You can try to rescue the construct by transformation into bacteria (please contact Customer Support for more information). You will not be charged for constructs that do not meet minimum yield.

To ensure that the manufacturing process is free from transmissible bovine diseases, Twist offers purified DNA constructs produced using non animal origin materials throughout the cloning, transformation, scale up, and purification processes.

Gene Fragments are assembled and then checked for size and purity by fragment analysis. They are not sequence-verified. Therefore, Gene Fragments are non-clonal (i.e. they are a mixture of perfect and non-perfect material). If you are planning to clone fragments, it is important that you screen more than one clone. Fragments can range in size from 300 to 5,000 bp in length.

Conversely, Clonal Genes are assembled and then cloned into either a custom vector or one of Twist's own catalog vectors. Clones are then NGS sequence verified to confirm that only the requested sequences are shipped and delivered. Clonal Genes can range in size from 300 to 5,000 bp in length. 

Currently, the maximum size for a gene fragment (linear double-stranded DNA) is 5 kb. The maximum size for a clonal gene (a gene cloned into a vector) is 5 kb.

Currently, the minimum size for our gene synthesis product (gene fragment or clonal gene) is 300 bp.

Twist Bioscience ships its DNA products dried down or resuspended in 2 mL microcentrifuge tubes, 96-well plates, or 384-well plates. Dried DNA is shipped at ambient temperature and resuspended DNA is shipped frozen.

Double-stranded DNA and single-stranded oligonucleotides are stable under most standard laboratory storage conditions. However, it is important to consider the following best practices to maintain the high quality of the DNA synthesized by Twist Bioscience.

• Twist recommends storing Dried DNA for the following durations based on storage condition.
  • Room Temperature for 3 months.
  • 4° C for 12 months.
  • -20° C for 24 months.
  • -80° C for long term storage.
• Resuspension Guidelines
  • For resuspension, briefly centrifuge the tube or plate before opening and resuspend in nuclease free Tris-EDTA (TE) buffer, pH 8.0 or 10 mM Tris-HCl, pH 8.0 to the desired concentration.
  • A concentration of at least 10 ng/μL is recommended for the stock dilution, but the optimal concentration will need to be determined based on your desired application.
  • Prepare aliquots of the stock dilution and separate working aliquots to limit chances of contamination and to reduce the number of freeze/thaw cycles. Use working aliquots as soon as possible after preparation and minimize exposure to high temperatures.
• Resuspended DNA
  • Resuspension is available for some products. Your DNA may arrive in one of the following buffers. We recommend briefly centrifuging the tube or plate before opening.
    • Elution buffer (2 mM Tris-Cl, pH 8.5)
    • TE buffer (10 mM Tris-Cl pH 8.0, 1 mM EDTA)
    • TE Buffer low EDTA (10 mM Tris-Cl pH 8.0, 0.1 mM EDTA)
    • Water       
      • We do not recommend long-term storage in water.
  • Twist recommends storing Resuspended DNA for the following durations based on storage condition.
    • Room Temperature for 3 months.
    • 4° C for 12 months.
    • -20° C for 24 months.
    • -80° C for long term storage.

When ordering a cloned gene, users have an option at checkout to select an integer mass of DNA to be delivered as part of their plasmid prep. Mass is automatically measured and ensured for the user. If we don’t hit the required mass in a single prep, we perform additional preps until we hit the required mass.

For Gene Fragments with adapters, the turnaround time is 2 to 4 business days, and for Gene Fragments without adapters, the turnaround time is 4 to 8 business days.

For Clonal Genes, the turnaround time starts at 4 to 7 business days for Express and 10 business days for Standard.

Timeline for Clonal Genes is based on the time it takes to complete synthesis and cloning successfully. If a gene fails at any step, it goes into our recovery pipeline and may be delayed. Optional services (like higher yield requests) may add to turnaround time.

We only have SDS documents for NGS products on our web page; for SDS documents for our Synthetic Biology products, please email us at customersupport@twistbioscience.com.